plx301 construct (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
plx301 construct
Plx301 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plx301/pLX301+(Plasmid+%2325895)/bio_rxiv__64898__2026__03__16__712096-216-24-29
Average 93 stars, based on 66 article reviews
Plx301 Construct, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/plx301/pLX301+(Plasmid+%2325895)/bio_rxiv__64898__2026__03__16__712096-216-24-29
Average 93 stars, based on 66 article reviews
plx301 construct - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Sertm2 is a conserved micropeptide that promotes GDNF-mediated motor neuron subtype specification Article Snippet: .. Article Title: RalB uncoupling from exocyst is required for endothelial Weibel-Palade body exocytosis Article Snippet: Moua Yanga,b, Alexandra Boye-Doec, Mohammed Alic, Salma A.S. Abosabiec,d,e, Alexandra M. Barrc, Lourdes M. Mendezc, and Anish V. Sharda ,c,* aBloodworks Northwest Research Institute, Seattle, WA 98102; bDivision of Hematology and Oncology, Department of Medicine, University of Washington School of Medicine, Seattle, WA 98102; cSection of Hematology, Yale Cancer Center, Yale University School of Medicine, New Haven, CT 06511; dInstitute of Experimental Biomedicine, University Hospital Würzburg, 97080 Würzburg, Germany; eRudolf Virchow Center for Integrative and Translational Bioimaging, Julius-Maximilians-Universität Würzburg, 97080 Würzburg, Germany Article Title: Failure to repair damaged NAD(P)H blocks de novo serine synthesis in human cells Article Snippet: .. Both the isoforms were cloned from pcDNA3.1 that contained the human full-length NAXD cDNA (RefSeq ID: NM_001242882.1; GenScript clone ID OHu08429) [ ]. Article Title: <scp>DeSUMOylating</scp> isopeptidase 1 participates in the faithful chromosome segregation and vincristine sensitivity Article Snippet: See the T erm s and C onditions (https://onlinelibrary.w iley.com /term s-and-conditions) on W iley O nline L ibrary for rules of use; O A articles are governed by the applicable C reative C om m ons L icense 4 of 21 | IKEDA et al. n2t. net/ addge ne: 17357 ; RRID:Addgene_17357)31], was ligated into the SalI–XbaI sites of the pENTR4- no- ccDB. .. The genes in the entry vectors were subcloned into the gateway destination vectors, pLIX402 [a gift from David Root (Addgene plasmid #41394; http:// n2t. net/ addge ne: 41394 ; RRID:Addgene_41394)], Article Title: DeSUMOylating isopeptidase 1 participates in the faithful chromosome segregation and vincristine sensitivity Article Snippet: To construct pENTR4‐no‐ccDB‐FLAG‐SENP1, a SENP1 fragment harboring SalI–XbaI sites, amplified with primers (5′‐AAAGTCGACACCATGGACTACAAAGACGATGACGACAAGC‐3′ and 5′‐AAATCTAGATCACAAGAGTTTTCGGTGGAGGATCTCCC‐3′) using the Flag‐SENP1 [a gift from Edward Yeh (Addgene plasmid #17357; http://n2t.net/addgene:17357 ; RRID:Addgene_17357) ], was ligated into the SalI–XbaI sites of the pENTR4‐no‐ccDB. .. The genes in the entry vectors were subcloned into the gateway destination vectors, pLIX402 [a gift from David Root (Addgene plasmid #41394; http://n2t.net/addgene:41394 ; RRID:Addgene_41394)], other:Article Title: Highly networked immunogen composition Article Snippet: Non-limiting examples of lentiviral vectors include pLVX-EF1alpha-AcGFP1-C1 (Clontech Catalog #631984), pLVX-EF1alpha-IRES-mCherry (Clontech Catalog #631987), pLVX-Puro (Clontech Catalog #632159), pLVX-IRES-Puro (Clontech Catalog #632186), pLenti6/V5-DESTTM (Thermo Fisher), pLenti6.2/V5-DESTTM (Thermo Fisher), pLKO.1 ( Article Title: Methods and compositions for increasing protein expression and/or treating a haploinsufficiency disorder Article Snippet: Non-limiting examples of lentiviral vectors include pLVX-EF1alpha-AcGFP1-C1 (Clontech Catalog #631984), pLVX-EF1alpha-IRES-mCherry (Clontech Catalog #631987), pLVX-Puro (Clontech Catalog #632159), pLVX-IRES-Puro (Clontech Catalog #632186), pLenti6/V5-DESTTM (Thermo Fisher), pLenti6.2/V5-DESTTM (Thermo Fisher), pLKO.1 ( Clone Assay:Article Title: Failure to repair damaged NAD(P)H blocks de novo serine synthesis in human cells Article Snippet: .. Both the isoforms were cloned from pcDNA3.1 that contained the human full-length NAXD cDNA (RefSeq ID: NM_001242882.1; GenScript clone ID OHu08429) [ ]. Article Title: An enhanced intracellular delivery platform based on a distant diphtheria toxin homolog that evades pre-existing antitoxin antibodies. Article Snippet: .. Similarly, to generate lentivirus for HEK293T SORT1 overexpression cell lines, SORT1 cDNA was obtained from the hORFeome V8.1 collection and cloned into Over Expression:Article Title: An enhanced intracellular delivery platform based on a distant diphtheria toxin homolog that evades pre-existing antitoxin antibodies. Article Snippet: .. Similarly, to generate lentivirus for HEK293T SORT1 overexpression cell lines, SORT1 cDNA was obtained from the hORFeome V8.1 collection and cloned into |